The Influence Of Candidate Gene Polymorphisms In Tuberculosis Among Selected Ethiopian Populations

Microbial, Cellular And Molecular Biology Project Topics

Get the Complete Project Materials Now! »

Background: Tuberculosis (TB) is an ancient malady that remains a modern global health concern. The ancient relationship between Mycobacterium tuberculosis (Mtb) and Homo sapiens has evolved into a spectrum of co-existence pattern which, from the human perspective, ranges from a complete and fatal susceptibility to TB to a total resistance to infection and/or progression to disease. Essentially, therefore, infection by Mtb, although necessary, is not a sufficient cause for TB disease and numerous studies have demonstrated that this spectrum of host-pathogen interaction outcome is mediated in part by the genetic constitution of individuals that impact their potential for innate and adaptive immunity against TB. However, there is a conspicuous lack of replication of results and the hunt for novel associations in different populations continues unabated. It has been suggested that the lack of power in the investigative process to identify genetic risk factors to TB emanate mainly from the lack of precision in the 'Definition of the Phenotype'. Because of the complexity of TB, a precise and consistent definition of the disease is a major challenge and it has been difficult to provide reliable TB phenotype definition criteria amenable for genetic epidemiological analysis. There is also the possibility of unaccounted differences in the genetic architecture of the studied populations and the potentially differential or minor effects of either rare or common variants identified in the studies. The primary aim of this genetic epidemiological study was 1) to investigate the role of genetic variations within candidate genes towards susceptibility to TB by resequencing genes which previously showed an association signal in another Sub-Saharan African cohort (Ugandan population), as well as 2) testing an original candidate gene hypothesis in Ethiopian populations. The study focused on three innately expressed genes: NOD1 [Nucleotide-binding Oligmerization Domain containing 1] and TICAM2 [Toll/Interleukin-1 Receptor Domain-Containing Adaptor iv rnMolecule 2], based on a recent finding in an East African population that indicated significant statistical association and another study demonstrating a biological plausibility of TICAM2-NOD1 synergistic action and, thus, were deemed to warrant an effort to replicate those findings in an independent population; and, FMO2 (Flavin-Containing-Monooxygenase-2) that demonstrates some curious characteristics vis-à-vis TB that come from some immunologic, pharmacogenetic, and population/evolutionary genetics observations. First, FMO2 is highly expressed in activated pulmonary-macrophages regulating oxidative-stress level, an essential mechanism of innate immunity against TB. In contrast, FMO2 is regarded as potentially deleterious because it causes adverse reactions to anti-TB drug treatment. Furthermore, FMO2 possesses a unique polymorphism, FMO2*1/FMO2*2 (rs6661174), with differential ethno-geographic distribution. The functional ancestral-variant, FMO2*1, is only found in African and some Hispanic populations with highest frequency in Sub-Saharan-Africa while Caucasians and Asians are homozygous for the dysfunctional derived-allele, FMO2*2. However, there are no reported investigations into the potential involvement of FMO2 in the pathogenesis of diseases exerting population-specific selective pressures. rnMethod: This study focused on finding a method of unraveling the TB-phenotype complexity by drawing TB-trait definitions closely based on its known natural progression stages from infection to disease onset. This ensures that intermediate stages of the disease are included as phenotypes of interest rather than just analyzing the final binary-trait outcome: 'Active-TB vs. No-active-TB' (presence/absence). An intermediate stage may be a distinct phenotype having its own immunogenetic profile that could otherwise be missed. TB cases and household controls (n=292) were ascertained from 3 different ethnic groups. Latent Mtb infection was determined v rnusing Quantiferon to develop reliable TB progression phenotypes. Exonic regions of TICAM2, NOD1, and FMO2 genes were sequenced. Various statistical tests of association were done that accounted for possible confounding by sex, age, and population stratification. Result: Multiple SNPs in FMO2, TICAM2 and NOD1 were associated with TB. Among the most significant findings were two SNPs in NOD1 achieving a study-wide significance threshold: rs751770147 [p=7.28x10-05] and chr7:30477156(T), a novel variant, [p=1.04x10-04]. Three SNPs in TICAM2 were nominally associated with TB, including rs2288384 [p=0.003]. Haplotype-based association tests supported the SNP-based results. The study also identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p=3.15E-07, OR=4.644 and chr1:171165749(T), p=3.32E-06, OR=6.825] while several SNPs (twenty two) showed nominal signals of association. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p=0.000103). Strikingly, not only was FMO2*1 associated with reduced risk to "Active TB" (p=0.0118, OR=0.496) but it also does not co-segregate with the other 5'-3' flanking top high-TB-risk alleles. rnConclusion: The study design not only helped to replicate previous association signals of TICAM2 and NOD1 with TB but also identified novel genetic variants associated with TB in Ethiopian populations thus further validating the genes' involvement in TB pathogenesis. The vi rnstudy also identified for the first time the association of FMO2 gene with TB and provided an evidence for the existence of an evolutionary adaptation to an ancient disease based on the ancestral FMO2*1 polymorphism. The study sheds light on the possible impact of host-pathogen co-evolution on the present differential ethno-geographic distribution of the FMO2*1 variant that coincides with the origin of both humans and Mtb in Sub-Saharan Africa. The novel discovery calls for a revision of the notion that FMO2*1 is "potentially deleterious". Rather, the study indicates that FMO2*1 is associated with reduced risk to TB progression acting in a haplotypic framework. The finding also puts into question the prudence of prescribing thiourea based anti-TB drug treatment regimens for populations harbouring high proportions of FMO2*1 without genetic screening. The study examined multiple ethnic groups in Ethiopia, and found that the association results are robust to population stratification. As Ethiopia is considered to be the origin of both humanity and Mtb, these findings are of particular significance for understanding Mtb-human co-evolution and the genetic underpinnings of TB in general.

Subsurface Intelligence & Critical Mineral Exploration

Modern Geology projects now focus on Machine Learning in Mineral Targeting, Carbon Capture & Storage (CCS) Geologic Modeling, and Critical Mineral Systems (Lithium, REEs). If your research involves Hydrogeological Connectivity, Seismic Inversion, or Geotechnical Site Characterization, ensure your analysis follows the JORC or NI 43-101 reporting standards and utilizes robust 3D Subsurface Visualization and Geochemical Fingerprinting frameworks.

Get Full Work

Report copyright infringement or plagiarism

Be the First to Share On Social



1GB data
1GB data

RELATED TOPICS

1GB data
1GB data
The Influence Of Candidate Gene Polymorphisms In Tuberculosis Among Selected Ethiopian Populations

718